Work Description

Date: 3rd, March 2023

Dataset Title: Untargeted lipidomics and targeted metabolomics analysis of Cardiolipin synthase deficient murine macrophages

Dataset Creators: M.B. Reynolds, H.S. Hong, L. Zhang, C.A. Lyssiotis, M.X. O'Riordan

Dataset Contacts: mbreyn@umich.edu (Mack Reynolds, PhD Student at time of data generation) and oriordan@umich.edu (Mary O'Riordan, PI)

Funding: National institute of Health (NIH) R01AI157384

Key Points:
- Lipid and metabolite analysis in macrophages during genetic perturbation of the biosynthesis of the mitochondrial phospholipid cardiolipin.
- Metabolite analysis during lipopolysaccharide stimulation in the context of cardiolipin biosynthesis perturbation.

Research Overview:
The mitochondrial phospholipid cardiolipin has been implicated in macrophage inflammatory programming. Our research focuses on the consequences
of cardiolipin biosynthesis perturbation for inflammatory metabolic remodeling through alterations in metabolite and lipid abundance.

Methodology:

Generation and immortalization of macrophage cell line from murine bone marrow: Murine immortalized bone marrow-derived macrophages (iBMDMs) were generated from female C57BL/6 mice. Briefly, recombinant Cre-J2 virus containing v-raf and v-myc oncogenes was generated in 3T3 fibroblasts grown
in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 50 U/ml of Penicillin and 50 µg/ml of Streptomycin. Sterile-filtered culture supernatants containing Cre-J2 virus were stored at −80°C. C57BL/6J lineage mouse femurs and tibiae were
flushed and cells were transduced with Cre-J2 virus in macrophage differentiation media (50% DMEM, 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 30% L929 cell-conditioned medium, 20% FBS, 50 U/ml of Penicillin and 50 µg/ml of Streptomycin). iBMDM were grown for at least 1 month before use in experiments to ensure immortalization was successful. L-929 cells were cultured in Minimum Essential Eagle Medium (MEM) supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 1 mM non-essential amino acid (NEAA), 10 mM HEPES, and 10% FBS. All experiments were performed in DMEM supplemented with 2 mM
L-glutamine, 1 mM Sodium Pyruvate and 10% FBS, unless otherwise indicated.

CRLS1 knockdown in immortalized macrophages through lentiviral expression of Crls1-targeted shRNA: Stable knock down (KD) of the terminal enzyme in the cardiolipin biosynthesis pathway Cardiolipin synthase (CRLS1) in iBMDM was achieved using lentiviral delivery of a construct encoding short hairpin RNA (shRNA). Lentivirus was generated and packaged in HEK293T cells grown in DMEM supplemented with 10% FBS. HEK293T cells were transfected with pLKO.1 plasmid encoding Crls1-targeted shRNA or a non-target control (NT-Control) along with the packaging plasmids (pHCMV-G, and pHCMV-HIV-1) using FUGENE-HD transfection reagent (Promega). The mouse Crls1-targeted shRNA plasmid with the sense sequence of GAAGACTTTAATGTTGCACTA and the non-target control shRNA plasmid were purchased from Sigma-Aldrich. Lentivirus-containing supernatants were collected, filtered, and used to transduce macrophage cell lines. Transduced cells were selected with puromycin (3 µg/ml) and resistant cells were grown and used for the experiments.

Data S1. Untargeted lipidomics analysis of CRLS1 KD and NT-Control immortalized macrophages: Wild type (WT), CRLS1 KD, and NT-Control macrophages (iBMDM) were grown overnight in DMEM supplemented with 10 mM glucose, 1 mM pyruvate, 2 mM glutamine, and 10% FBS. Mitochondria were isolated as described above, flash frozen in liquid nitrogen, and stored at −80°C. Mitochondrial isolates were quality controlled and tested for cytosolic contamination by immunoblot analysis of TOM20 and GAPDH, and total protein stains from SDS-PAGE separated mitochondrial fractions (Revert 700, LI-COR) were used for sample loading normalization for lipidomics data. Untargeted lipidomics analysis was performed after general lipid extraction using a methyl-tert-butyl ether (MTBE)-based liquid-liquid protocol. Samples were thawed at RT and 200 µL of PBS and 500 mL methanol containing 20 mL of an internal standard mixture (custom mixture from Cayman Chemical; see associated documentation) were added to each sample. Samples were vortexed, and 1000 mL methanol and 5 mL MTBE were sequentially added to each sample. After additional vortexing, the mixture was incubated on a tabletop shaker at 500 rpm at RT for 1 hour. Phase separation was induced by the addition of 1.25 mL water. Samples were sonicated for 10 minutes, then centrifuged at 2000 x g for 20 minutes. The upper organic phase of each sample was carefully removed using a Pasteur pipette and transferred into a clean glass tube. The remaining aqueous phase was re-extracted with 2.5 ml of the upper phase of MTBE/methanol/water 10:3:2.5 (v/v/v) solvent mixture, whose composition was similar to the expected composition of the upper phase. After vortexing and centrifugation as above, the organic phase was collected and combined with the initial organic phase. The extracted lipids were dried overnight in a SpeedVac concentrator. The dried lipid extracts were reconstituted in 200 µL n-butanol/methanol 1:1 (v/v)
and transferred into autosampler vials for analysis by LC-MS/MS. Lipostar software (Version 2.0.2b3; Molecular Discovery) was used for feature detection, noise and artifact reduction, alignment, normalization, and lipid identification. Significantly changed lipids between CRLS1 KD and NT-Control macrophages were identified using unpaired T-tests and filtering of P < 0.05 and absolute value of log2(fold change) > 0.5.

Data S2. Targeted metabolomics analysis of CRLS1 KD and NT-Control immortalized macrophages: CRLS1 KD, and NT-Control macrophages (iBMDM) were grown overnight in DMEM supplemented with 10 mM glucose, 1 mM pyruvate, 2 mM glutamine, and 10% FBS and then stimulated with or without lipopolysacchardie (LPS) (200 ng/mL) for 4, 8, or 24h. Stimulation was synchronized such that cells across conditions were in culture for the same amount of time. After stimulation, cells were washed twice with ice cold DPBS, and metabolites were extracted by adding cold 80% methanol, incubating at -80°C for 10 min, followed by centrifugation at 17,000 x g for 10 min at 4°C. The resulting metabolite supernatant was collected. Metabolite extracts were normalized to protein content from paired samples, and the normalized fraction was dried using a SpeedVac at 4°C for 8h. Dried metabolite pellets were resuspended in a 50:50 mixture of MeOH and water. Liquid chromatography-based targeted tandem mass spectrometry (LC-MS/MS)-based metabolomics were performed and the data analyzed. In brief, samples were run on an Agilent 1290 Infinity II LC -6470 Triple Quadrupole (QqQ) tandem mass spectrometer system consisting of the 1290 Infinity II LC Flexible Pump (Quaternary Pump), the 1290 Infinity II Multisampler, the 1290 Infinity II Multicolumn Thermostat with 6 port valve and the 6470 triple quad mass spectrometer. Agilent Masshunter Workstation Software LC/MS Data Acquisition for 6400 Series Triple Quadrupole MS with Version B.08.02 was used for compound optimization, calibration, and data
acquisition. Significantly changed metabolites between CRLS1 KD and NT-Control macrophages were identified using T-tests and filtering of P < 0.05 and absolute
value of log2(fold change) > 0.5.

Instrument and/or Software specifications: Detailed instrumentation and software information for lipidomics are presented in the methodology and in the tables below.
Instrument and software information for metabolomics are described in the methodology.

Technical informaton related to Data S1:

Cayman ID # Sample Name Species Sample type (plasma, urine, etc.) Volume Assay(s) Normalization factor
1 NT-Control iBMDM - 1 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 0.910004875
2 Unrelated to publication
3 CRLS1 KD iBMDM - 1 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 1.050467322
4 Unrelated to publication
5 NT-Control iBMDM -2 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 2.428760499
6 Unrelated to publication
7 CRLS1 KD iBMDM - 2 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 0.717904916
8 Unrelated to publication
9 NT-Control iBMDM - 3 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 1.339735331
10 Unrelated to publication
11 CRLS1 KD iBMDM - 3 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 1.690451741
12 Unrelated to publication
13 WT iBMDM - 1 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 2.140602382
14 Unrelated to publication
15 WT iBMDM - 2 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 0.868694822
16 Unrelated to publication
17 WT iBMDM - 3 Mouse cell line Mitochondrial fraction Pellet Untargeted lipidomics 1.529259336
18 Unrelated to publication

iBMDM = CRE-J2 virus immortalized bone marrow-derived murine macrophage
KD = shRNA based knockdown
NT = nontarget control shRNA

Internal Standard Cayman Item # Concentration in Mix (µg/mL) Polarity Used to Normalize
TG(16:0-d9/16:0/16:0) 30181 10 Positive TG, all pos-ion features not covered below
DG(16:0-d9/16:0/0:0) 28781 5 Positive DG
SM(d18:1/16:0-d9) 30141 5 Positive SM
Cer(d18:1-d7/16:0) 22787 5 Positive Cer
CE(16:0-d9) 30134 50 Positive CE
PE(16:0-d9/16:0) 30597 5 Negative PE, all neg-ion features not covered below
FA(16:0-d9) 30557 40 Negative FA
PS(16:0-d9/16:0) 30706 10 Negative PS
PC(16:0-d9/16:0) 30581 10 Negative PC
PC(16:0-d9/0:0) 30580 5 Negative LysoPC

LC Parameters
Instrument Ultimate 3000 UPLC
Injection Volume 5 µL
Column Accucore 2.6 µm C30 150 x 2.1 mm, Thermo Scientific
Flow Rate 300 µL/min
Mobile Phase A Acetonitrile/water/formic acid 60:40:0.1 (v/v/v), 10 mM ammonium formate
Mobile Phase B Acetonitrile/isopropanol/formic acid 10:90:0.1 (v/v/v), 10 mM ammonium formate
Column Temperature 40 °C
Gradient Minute % Pump B
0 30
5 43
5.1 50
14 70
14.1 70
21 99
28 99
28.1 30
33 30

MS Parameters
Instrument Q-Exactive Plus Orbitrap, Thermo Scientific
Ionization Electrospray (ESI)
Polarity Positive and Negative Dual
Spray Voltage (kV) 3.0 (Positive); 3.2 (Negative)
Capillary Temp (°C) 200
Sheath Gas Flow Rate 60
Aux Gas Flow Rate 20
S-lens RF Level 45
Collision Energy (eV) 28
Scan Type MS and dd-MS2
Mass Resolution 70000 (MS); 35000 (ddMS2)
Scan Range Positive: 400-1200 m/z; Negative: 250-1500 m/z
AGC (Max IT) MS: 1e6 (200 ms); ddMS2: 1e5 (200 ms)
TopN 5
Isolation Window 1.0 m/z

Technical informaton related to Data S2:

Column heading
Identifier Cell line Stimulation
NTM NT-Control iBMDM Mock-treated
NT4 NT-Control iBMDM 4h LPS
NT8 NT-Control iBMDM 8h LPS
NT24 NT-Control iBMDM 24h LPS
KDM CRLS1 KD iBMDM Mock-treated
KD4 CRLS1 KD iBMDM 4h LPS
KD8 CRLS1 KD iBMDM 8h LPS
KD24 CRLS1 KD iBMDM 24h LPS

1,2,3 following each identifier (e.g. NTM 1) indicates an experimental replicate.

iBMDM = CRE-J2 virus immortalized bone marrow-derived murine macrophage
KD = shRNA based knockdown
NT = nontarget control shRNA
LPS = Salmonella Typhimurium-derived lipopolysaccharide (200 ng/mL)
h = hours

Files contained here:
Data S1: Lipidomics dataset (values are normalized peak area)
Data S2: Metabolomics dataset (values are peak area)

Related publication(s):
Reynolds M.B. et al. (2023). Cardiolipin coordinates inflammatory metabolic reprogramming through regulation of Complex II disassembly and degradation. Science Advances, 9(5). DOI: 10.1126/sciadv.ade8701

Use and Access:
This data set is made available under a Attribution 4.0 International license (CC BY 4.0)

To Cite Data:
Reynolds, M. B., Hong, H. S., Zhang, L., Lyssiotis, C. A., O'Riordan, M. X. Untargeted lipidomics and targeted metabolomics analysis of Cardiolipin synthase deficient murine macrophages [Data set], University of Michigan - Deep Blue Data. https://doi.org/10.7302/3pv4-7z56